Journal of Men's Health,2023,19(9):15-25 DOI:10.22514/jomh.2023.082
Original Research

Testosterone promotes human foreskin fibroblast growth through miR-143-3p targeting IGFBP-3

Qian-Long Peng1, Yao-Wang Zhao1, Wen Tian1,*,

1Department of Urology, Hunan Children’s Hospital, 410007 Changsha, Hunan, China

*Corresponding Author(s):hnsetyy2022@163.com (Wen Tian)

History Submitted: 18 November 2022 | Accepted: 25 May 2023 | Published: 30 September 2023
Copyright:  ©2023  The Author(s). Published by MRE Press.
This is an open access article under the CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/).

Collapse table of contents

Abstract

Testosterone is an important male hormone, which could improve the maintenance and recovery of gonadal function in males as well as the repair of human hypospadias and cell fibrosis. Our study focused on investigating the regulatory effect of testosterone in human foreskin fibroblasts (HFF-1) and regulatory mechanisms involved. In this study, HFF-1 cells were treated with testosterone, and cell viability and migration were assessed by cell counting kit-8 (CCK8) and Transwell assays. The expression levels of androgen receptor (AR), miR-143-3p and insulin-like growth factor binding protein-3 (IGFBP-3) were measured by quantitative real-time PCR (qRT-PCR), Western blotting, and immunofluorescence. In addition, a potential binding site for miR-143-3p on IGFBP-3 was predicted and its direct binding was further confirmed by a dual luciferase reporter assay. These results showed that testosterone increased the viability and migration of HFF-1 cells. Testosterone could down-regulate miR-143-3p and up-regulate IGFBP-3 and AR. Overexpression of miR-143-3p hindered HFF-1 cell viability and negatively regulated IGFBP-3, whereas inhibition of IGFBP-3 impeded cell viability and migration. Furthermore, miR-143-3p was found to directly bind to IGFBP-3. Overexpression of IGFBP-3 countered the regulation of HFF-1 cells by miR-143-3p mimics. In conclusion, this study showed that testosterone promoted the proliferation and migration of HFF-1 cells and AR signaling, at least via the miR-143-3p/IGFBP-3 axis. This discovery presents a novel insight for testosterone application in male disorders like hypospadias.

Keywords:Testosterone;miR-143-3p;IGFBP-3;HFF-1 cells
PDF(2.56 MB)|EndNote (RIS)|BibTeX|RefMan|RefWorks

Cite this article

Qian-Long Peng, Yao-Wang Zhao, Wen Tian. Testosterone promotes human foreskin fibroblast growth through miR-143-3p targeting IGFBP-3.Journal of Men's Health,2023,19(9):15-25 DOI:10.22514/jomh.2023.082

1. Introduction

Hypospadias, a congenital malformation in male newborns, is the second most common with a prevalence of 1 in 200–300 in newborn males [1]. However, the etiology of most patients with hypospadias remains unclear. Hypospadias is thought to be a clinical manifestation of the interaction of hormonal and genetic factors during the development of the external genitalia [2]. Recent epigenetic investigations have identified an imbalance in human foreskin fibroblasts (HFF) as an important aspect of the disease etiology [3]. Previous studies have reported that low doses of bisphenol A can regulate the pathological development of hypospadias and that the progression might be related to dysregulated gene expression in HFF [4]. Therefore, targeting the growth of foreskin fibroblasts may provide potential concepts for disease treatment.

The growth and development of male external genitalia are primarily regulated by androgens. Testosterone, an endogenous androgen, exerts potent androgenic effects and other biological activities. Besides, testosterone is a widely prescribed drug. Several studies have found that testosterone plays a crucial role in male gonadal dysfunction, cardiovascular disease, and type 2 diabetes [5, 6, 7]. Research has also demonstrated that testosterone can result in abnormal proliferation of prostatic epithelial and stromal tissues [8, 9]. Additionally, previous evidence highlights the efficacy of testosterone in the repair of human hypospadias and in treating other male diseases [10]. A recent study showed that the local application of testosterone to human foreskin tissue has been found to increase the density of blood vessels and reduce fibrosis [11]. Nevertheless, there is a paucity of studies investigating the effect of testosterone on HFF growth in order to mediate the development of hypospadias.

MicroRNAs (miRNAs) consist of 19–23 nucleotides and are a form of small non-coding RNAs. They help regulate disease progression by inhibiting the expression of target mRNAs by preventing their translation or promoting their degradation [12]. Furthermore, miRNAs also have been demonstrated to be participated in various cellular processes that control disease progression [13]. Testosterone has been found to target miRNAs to influence fat deposition and carcinogenesis in breast tissue [14, 15]. However, the role of testosterone in regulating miRNA levels and its ability to impact hypospadias remains unknown. Previous studies have demonstrated that miR-143-3p regulates specific target genes to control the onset and progression of various diseases, including pneumonia [16], rheumatoid arthritis [17], and tumors [18, 19]. In addition, miR-143-3p can regulate prostate cell differentiation, proliferation, and apoptosis [20]. A study previously reported the translocation of miR-143-3p in early passaged and senescent HFFs by utilizing a miRNA microarray dataset and verified that miR-143-3p hindered early HFF proliferation and induced cell cycle arrest [21]. Therefore, we hypothesize that miR-143-3p is a potential target of testosterone.

The insulin-like growth factor binding protein (IGFBP) family consists of peptides that share similar structures, each approximately 260 amino acids long [22]. These peptides display different binding sites for miRNAs and are crucial in cell apoptosis and angiogenesis [23, 24]. In addition, IGFBP can combine with IGF to influence cell proliferation, migration, differentiation, angiogenesis and apoptosis [25]. IGFBP-3 is a polypeptide, and the function of IGFBP-3 largely depends on the cellular environment. IGFBP-3 plays a vital role in circulation due to its high affinity with IGF [26, 27]. According to research, IGFBP-3 regulates smooth muscle cell proliferation and apoptosis in the corpus cavernosum and also modulates oxidative stress and fibrosis [28]. IGFBP-3 is involved in regulating the growth and migration of castration-resistant prostate cancer cells [29]. Additionally, previous study showed that testosterone can stimulate the secretion of IGFBP-3 in HFF [30], although the exact regulatory mechanism is yet to be elucidated.

The purpose of this study was to examine the impact of testosterone on HFF-1 cell growth and proliferation and identify the regulatory mechanism involving miR-143-3p. Our findings offer novel evidence and understanding for the potential use of testosterone in hypospadias repair or other urinary system diseases, as well as fibrosis-related diseases.

2. Materials and methods

2.1 Cell acquisition and culture

Human foreskin fibroblasts (HFF-1) cells (CBP60935) were sourced from COBIOER (Nanjing, China) and maintained in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The cells were cultivated under an incubation of 37 °C and 5% CO2, and utilized for experimentation after 3–4 days of growth. Cells in the logarithmic growth period were grown until they were adherent (24 h) and were ready for subsequent treatments in six-well plates (2 × 105 cells/well).

To investigate the role of testosterone, HFF-1 cells were grouped as follows: Normal group consisting of cells in their usual state, and the Testosterone group consisting of cells treated with 10 nM testosterone for 24 h after growing adherently [30]. Testosterone (58-22-0) was ordered from Sigma-Aldrich (St. Louis, MO, USA) to explore the regulatory effect of testosterone in HFF-1 cells.

To study the impact of miR-143-3p effect, HFF-1 cells were grouped as follows: Normal control (NC) mimics group consisting of cells transfected with NC mimics for 48 h after growing adherently, the miR-143-3p mimics group consisting of cells transfected with miR-143-3p mimics for 48 h after growing adherently. Afterwards, both groups were exposed to 10 nM testosterone for 24 h.

To evaluate the function of IGFBP-3, HFF-1 cells were divided into four groups: the si-NC group consisting of cells transfected with si-NC for 48 h after growing adherently, and the si-IGFBP3 group consisting of cells transfected with si-IGFBP3 for 48 h after growing adherently. Afterwards, both groups were exposed to 10 nM testosterone for 24 h.

To determine whether miR-143-3p functions through IGFBP-3, HFF-1 cells were divided into four groups: the NC mimics group consisting of cells transfected with NC mimics for 48 h after growing adherently, the miR-143-3p mimics group consisting of cells transfected with miR-143-3p mimics for 48 h after growing adherently, the miR-143-3p mimics + oe-NC group consisting of cells co-transfected with miR-143-3p mimics and oe-NC for 48 h after growing adherently, and the miR-143-3p mimics + oe-IGFBP3 group consisting of cells co-transfected with miR-143-3p mimics and oe-IGFBP3 for 48 h after growing adherently. Afterwards, all groups were exposed to 10 nM testosterone for 24 h.

2.2 Cell transfection

Plasmids si-NC, si-IGFBP3, oe-NC and oe-IGFBP3, along with lentiviruses (miR-143-3p mimics and NC mimics) were synthesized by GenePharma (Shanghai, China). The transfection of plasmids and/or lentiviruses into HFF-1 cells was carried out using Lipofectamine 2000 reagent (11668019, Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions, and the cells were incubated for 48 h. Plasmids oe-NC and oe-IGFBP3 (HG-HO000598) were acquired from HonorGene (Changsha, China). The sequence of IGFBP-3 was obtained from NCBI, and primers were designed to isolate the target gene. The target fragment was then ligated into the pcDNA3.1(+) vector.

2.3 Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted by Trizol from HFF-1 cells, and the concentration of RNA was measured by a spectrophotometer. Reverse transcription was then carried out with a reverse transcription kit (CW2569, CWBIO, Taizhou, China) following the manuals. Subsequently, we performed qRT-PCR with UltraSYBR Mixture (CW2601, Taizhou, CWBIO, China) using cDNA as the template and the primer sequences given in Table 1. The qRT-PCR was performed on PIKOREAL96 system from Thermo Fisher Scientific (Waltham, MA, USA). Relative levels were calculated and analyzed by the 2−ΔΔCT method with normalizing β-actin and U6 [31].

Table 1.Primer sequences.
NameSequences
β-actinForward ACCCTGAAGTACCCCATCGAG Reverse AGCACAGCCTGGATAGCAAC
U6Forward CTCGCTTCGGCAGCACA Reverse AACGCTTCACGAATTTGCGT
IGFBP-3Forward AGTAATGGCACAATTCTTCGGAT Reverse CTATGTGCTCCCAGTGTCC
miR-143-3pForward TGAGATGAAGCACTGTAGCTC Reverse GCTGTCAACGATACGCTACGTA
IGFBP: insulin-like growth factor binding protein.

2.4 Western blotting

Western blot analysis of HFF-1 cells was performed as described previously [32]. Cells were washed with pre-cooled phosphate buffer saline (PBS) and then mixed with radio immunoprecipitation assay (RIPA) lysis solution (AWB0136b, Abiowell, Changsha, China). The samples were then collected and crushed by ultrasound after scraping the cell suspension with a cell scraper. After lysing for 10 min, the supernatant was collected into 1.5 mL tubes by centrifugation. Protein concentrations were then determined with a bicinchoninic acid (BCA) protein quantitative kit (AWB0104, Abiowell, Changsha, China), and 5× loading buffer was replenished to each sample before boiling them in water for 5 min. Next, protein samples were separated by electrophoresis and transferred to nitrocellulose (NC) membranes with a constant current through a DYCZ-40D mini transfer electrophoresis apparatus (LIUYI, Beijing, China). Next, the membranes were incubated in 5% skimmed milk powder (Yancheng Saibao, Yancheng, China) at normal temperature for 1 h and sealed at 4 °C overnight. Then, we added primary antibodies, including IGFBP-3 (10189-2-AP, 1:500, Proteintech, Chicago, IL, USA), androgen receptor (AR, 22089-1-AP, 1:5000, Chicago, IL, Proteintech, USA), and β-actin (66009-1-Ig, 1:5000, Chicago, IL, Proteintech, USA). The following day, secondary antibodies, including HRP goat anti-mouse IgG (SA00001-1, 1:5000, Chicago, IL, Proteintech, USA), HRP goat anti-rabbit IgG (SA00001-2, 1:6000, Chicago, IL, Proteintech, USA) were added to the membranes after three washes with PBST (PBS containing 0.05% Tween 20) and incubated at room temperature for 1.5 h. The electrochemiluminescence (ECL) was used for development, and the images were acquired with a gel imaging system. Lastly, protein band densities were quantified by Quantity one 4.6 software (Bio-Rad, Hercules, CA, USA) and presented as histograms.

2.5 Measure of cell viability by cell counting kit-8 (CCK8) assay

HFF-1 cell viability evaluated by CCK8 assays as previously reported [33]. In brief, HFF-1 cells were incubated in a 96-well plate (0030730119, Eppendorf, Germany) with 5 × 103 cells per well at a volume of 100 µL (5 replicate wells for each group). The cells were incubated in the dark at 37 °C for 24 h. After 24 h of incubation, 10 µL of CCK8 reagent (NU679, Dojindo, Kumamoto Ken, Japan) was added to each well, and the cells were further incubated at 37 °C with 5% CO2 for 4 h. The absorbance of each sample was measured using a Bio-Tek microplate analyzer (MB-530, Heales, Shenzhen, China). The growth inhibition rate was calculated based on the mean value of the absorbance readings.

2.6 Immunofluorescence (IF)

AR expression was determined by IF as described previously [34]. To prepare the histological sections, they were initially baked at 60 °C for 12 h and then cleared in xylene for 20 min. Subsequently, they were subjected to a series of ethanol, including 75%, 85%, 95% and 100% concentrations (5 min at each grade), followed by a pure water wash. Sections were immersed into ethylene diamine tetraacetic acid (EDTA) buffer and exposed to continuous microwave heating for 24 min. After cooling, the cells were rinsed with 0.01 M PBS (Abiowell, Changsha, China), followed by immersion in a sodium borohydride solution. Cells were soaked in 75% ethanol solution for 1 min, after which Sudan Black dye was applied. The sections were sealed in 5% bovine serum albumin (BSA) for 1 h before being incubated with AR antibody (Ab133273, 1:50, Abcam, Cambs, UK) at 4 °C overnight. The following morning, sections were incubated with conjugated Affinipure Goat Anti-Rabbit IgG (H+L) secondary antibody (SA00013-2, proteintech, Chicago, IL, USA) at 37 °C for 60–90 min. DAPI (4,6-diamidine-2-phenylindole dihydrochloride) was applied for staining nuclear at 37 °C. Finally, the sections were sealed with glycerol buffer before being observed under a fluorescence microscope.

2.7 Transwell assays

Cell migration was assessed by Transwell chambers as previously described [35]. The lower layer of the transwell chamber (3428, Corning Incorporated, Corning, NY, USA) was filled with 500 µL of DMEM containing 10% FBS. HFF-1 cells were trypsinized and suspended in serum-free DMEM at a density of 2 × 106/mL. Subsequently, 100 µL of the cells were added to each well and the chamber was incubated at 37 °C for 48 h. After incubation, the upper chamber was removed and the cells placed in new wells containing PBS (SH30256.01, Hyclone, South Logan, UT, USA). The cells were then fixed using 4% paraformaldehyde and stained using 0.1% crystal violet. The upper surface cells were visualized using an inverted microscope. After that, the chamber was taken out and 500 µL of 10% acetic acid was added for depigmentation. The optical density (OD) value was determined three times using a microplate analyzer at 550 nm.

2.8 Dual-luciferase reporter assays

First, we predicted that the binding sites of miR-143-3p on IGFBP-3 by applying the “miRNA and Targets” function at https://starbase.sysu.edu.cn/ [36]. As previously described [37], the regulatory elements of the target gene were artificially mutated according to the predicted binding sites. Then, the wild-type (WT) and mutated (MUT) sequences were inserted into expression vectors with firefly luciferase to control the transcriptional expression of luciferase. HFF-1 cells were divided into four groups: the NC mimics + IGFBP-3 WT group (HFF-1 cells were co-transfected with pHG-miRTarget-IGFBP-3 WT-3U plasmid and NC mimics at a final concentration of 50 nM), the miR-143-3p mimics + IGFBP-3 WT group (HFF-1 cells were co-transfected with pHG-miRTarget-IGFBP-3 WT-3U plasmid and miR-143-3p mimics at a final concentration of 50 nM), the NC mimics + IGFBP-3 MUT group (HFF-1 cells were co-transfected with pHG-miRTarget-IGFBP-3 MUT-3U plasmid and NC mimics at a final concentration of 50 nM), and the miR-143-3p + IGFBP-3 MUT group (HFF-1 cells were co-transfected with pHG-miRTarget-IGFBP-3 MUT-3U plasmid and miR-143-3p mimics at a final concentration of 50 nM). A luciferase detection kit (E1910, Promega, Madison, WI, USA) was applied to measure the activities of firefly and renilla luciferases in the four groups in GloMax 20/20 (Promega, Madison, WI, USA) according to the product instructions. Renilla luciferase was used as an internal reference.

2.9 Data analysis

GraphPad Prism 8.0 statistical software (Graphpad, La Jolla, CA, USA) was applied for data processing [38]. The Student’s t-test and one-way analysis of variance (ANOVA) were used to analyze and calculate the significance of the difference between the different groups. p < 0.05 was statistically significant.

3. Results

3.1 Testosterone promoted migration and proliferation of HFF-1 cells

Recent evidence suggests that an imbalance in human foreskin fibroblasts is an important part of the hypospadias etiology [3, 4]. Testosterone is an endogenous androgen that contributes to hypospadias repair in humans [10]. Therefore, we applied testosterone reagent to HFF-1 cells for 24 h to assess the impact of testosterone on the proliferation and migration of these cells. The CCK8 assays revealed that the Testosterone group had significantly higher cell viability than the Normal group (Fig. 1A). The Testosterone group also showed higher levels of cell migration compared to the Normal group (Fig. 1B). Our observations suggested that testosterone contributed to promoting the proliferation and migration of HFF-1 cells.

Androgen receptor (AR) can bind to testosterone and regulate cell differentiation and proliferation, thus mediating prostate organogenesis and development [39]. AR is closely associated with the development of hypospadias, and testosterone increases AR expression in fibroblasts [40, 41]. Consequently, we examined the expression of AR in each group to investigate whether testosterone affects AR signaling. The fluorescence intensity of AR in the Testosterone group were elevated compared to the Normal group (Fig. 1C). Western blotting further confirmed that the abundance of AR in the Testosterone group was greater (Fig. 1D). These findings indicated that testosterone promoted the expression of AR.

Detection of HFF-1 cell proliferation and migration. (A) CCK8 assays were used to measure cell viability. (B) Transwell assay for cell migration. Scale bar = 100 µm. (C) The expression of AR was determined by immunofluorescence. Scale bar = 25 µm. (D) The protein abundance of AR was analyzed by western blotting. The student’s t-test was used to analyze statistical significance. *p &lt; 0.05 vs. Normal group. AR: androgen receptor; DAPI: 4,6-diamidine-2-phenylindole dihydrochloride.

Fig. 1.Detection of HFF-1 cell proliferation and migration. (A) CCK8 assays were used to measure cell viability. (B) Transwell assay for cell migration. Scale bar = 100 µm. (C) The expression of AR was determined by immunofluorescence. Scale bar = 25 µm. (D) The protein abundance of AR was analyzed by western blotting. The student’s t-test was used to analyze statistical significance. *p < 0.05 vs. Normal group. AR: androgen receptor; DAPI: 4,6-diamidine-2-phenylindole dihydrochloride.

3.2 Testosterone regulated the expression of miR-143-3p and IGFBP-3 in HFF-1 cells

Next, we attempted to explore the underlying mechanism. Testosterone can target miRNA to regulate disease development [14, 15]. In a prior study, it was found that miR-143-3p hindered early HFF proliferation [21]. Evidence has indicated that miR-143-3p/IGFBP was shown to be involved in the osteogenic differentiation of dental pulp stem cells [42]. Additionally, testosterone could stimulate the secretion of IGFBP-3 in HFF [30]. This prompted us to investigate if miR-143-3p/IGFBP-3 was a potential target of testosterone.

To determine whether testosterone-mediated HFF-1 cell growth involves miR-143-3p and IGFBP-3, we measured the expression levels of these molecules using qRT-PCR in HFF-1 cells. We observed a significant down-regulation of miR-143-3p expression in the Testosterone group when compared to the Normal group, whereas the relative levels of IGFBP-3 were significantly higher in the Testosterone group (Fig. 2A). The western blotting data for IGFBP-3 expression were in agreement with the qRT-PCR results (Fig. 2B), which confirms that testosterone has a regulatory impact on miR-143-3p and IGFBP-3 in HFF-1 cells. Accordingly, these findings indicated that miR-143-3p/IGFBP3 could act as a target of testosterone.

Down-regulation of miR-143-3p and up-regulation IGFBP-3 in HFF-1 cells. (A) Expression levels of miR-143-3p and IGFBP-3 by qRT-PCR. (B) Protein abundance of IGFBP-3 by western blotting. The student’s t-test was used to analyze statistical significance. *p &lt; 0.05 vs. Normal group. IGFBP-3: insulin-like growth factor binding protein-3.

Fig. 2.Down-regulation of miR-143-3p and up-regulation IGFBP-3 in HFF-1 cells. (A) Expression levels of miR-143-3p and IGFBP-3 by qRT-PCR. (B) Protein abundance of IGFBP-3 by western blotting. The student’s t-test was used to analyze statistical significance. *p < 0.05 vs. Normal group. IGFBP-3: insulin-like growth factor binding protein-3.

3.3 miR-143-3p targeted IGFBP-3

Having established that testosterone impacts the expression of both miR-143-3p and IGFBP-3, we sought to investigate whether miR-143-3p targeted IGFBP-3. The prediction results from specialist software suggested that miR-143-3p and IGFBP-3 had a binding site (Fig. 3A), thus indicating miR-143-3p could target IGFBP-3. To confirm this, we carried out a dual-luciferase reporter assay to assess the binding between miR-143-3p and IGFBP-3. Our data demonstrated that compared to the NC mimics + IGFBP-3 WT group, the luciferase intensity of the miR-143-3p mimics + IGFBP-3 WT group was lower. In contrast, the luciferase intensity of the miR-143-3p mimics + IGFBP-3 MUT group was similar to that of the NC mimics + IGFBP-3 MUT group (Fig. 3B), which confirmed that miR-143-3p can bind to IGFBP-3.

Prediction and validation of miR-143-3p targeting IGFBP-3. (A) Bioinformatics prediction of the target relationship between miR-143-3p and IGFBP-3. (B) Dual-luciferase reporter assays were used for the validation of miR-143-3p targeting IGFBP-3. One-way ANOVA was used to analyze statistical significance. *p &lt; 0.05 vs. NC mimics + IGFBP3 WT group. WT: wild-type; MUT: mutated; IGFBP-3: insulin-like growth factor binding protein-3.

Fig. 3.Prediction and validation of miR-143-3p targeting IGFBP-3. (A) Bioinformatics prediction of the target relationship between miR-143-3p and IGFBP-3. (B) Dual-luciferase reporter assays were used for the validation of miR-143-3p targeting IGFBP-3. One-way ANOVA was used to analyze statistical significance. *p < 0.05 vs. NC mimics + IGFBP3 WT group. WT: wild-type; MUT: mutated; IGFBP-3: insulin-like growth factor binding protein-3.

3.4 Overexpression of miR-143-3p inhibited the growth-promoting effect of testosterone on HFF-1 cells

Next, we wondered whether the regulation of testosterone on HFF-1 cells was through miR-143-3p/IGFBP3. To delve deeper into the effect of miR-143-3p on HFF-1 cells, we treated testosterone-exposed HFF-1 cells with miR-143-3p mimics. As a result, miR-143-3p mimics elevated the level of miR-143-3p compared to the NC mimics group (Fig. 4A). We found that cell viability in the miR-143-3p mimics group was notably inhibited (Fig. 4B), indicating that overexpression of miR-143-3p hindered HFF-1 cell viability. In addition, the abundance of IGFBP-3 exhibited a downward trend in the miR-143-3p mimics group (Fig. 4C). Our results indicated that miR-143-3p interfered with the proliferation of testosterone-exposed HFF-1 cells and limited the expression of IGFBP-3.

miR-143-3p could limit HFF-1 cell growth and IGFBP-3 expression. (A) qRT-PCR for measurement of miR-143-3p expression. (B) CCK8 assays for HFF-1 cell viability. (C) Western blotting for analysis of the abundance of IGFBP-3. The student’s t-test was used to analyze statistical significance. *p &lt; 0.05 vs. NC mimics group. NC: nitrocellulose; IGFBP-3: insulin-like growth factor binding protein-3.

Fig. 4.miR-143-3p could limit HFF-1 cell growth and IGFBP-3 expression. (A) qRT-PCR for measurement of miR-143-3p expression. (B) CCK8 assays for HFF-1 cell viability. (C) Western blotting for analysis of the abundance of IGFBP-3. The student’s t-test was used to analyze statistical significance. *p < 0.05 vs. NC mimics group. NC: nitrocellulose; IGFBP-3: insulin-like growth factor binding protein-3.

3.5 IGFBP-3 silencing attenuated the growth-promoting effect of testosterone on HFF-1 cells

Next, we transfected IGFBP-3 silencing sequences into testosterone-induced HFF-1 cells to assess the function of IGFBP-3. The relative mRNA level of IGFBP3 was reduced by si-IGBP3 compared to the si-NC group (Fig. 5A). The protein abundance of IGFBP-3 was reduced in the si-IGFBP3 group (Fig. 5B). In addition, si-IGFBP3 also restricted HFF-1 cell proliferation and migration (Fig. 5C,D). In a word, our findings indicated that IGFBP-3 silencing impeded testosterone-induced cell proliferation and migration and limited the expression of IGFBP-3 in HFF-1 cells.

IGFBP-3 silencing inhibited the growth of HFF-1 cells. (A) qRT-PCR for measurement of IGFBP-3 expression. (B) The abundance of IGFBP-3 was examined by western blotting. (C) The viability of HFF-1 cells was detected by CCK8 assays. (D) Transwell assay for cell migration. Scale bar = 100 µm. The student’s t-test was used to analyze statistical significance. *p &lt; 0.05 vs. si-NC group. NC: nitrocellulose; IGFBP-3: insulin-like growth factor binding protein-3.

Fig. 5.IGFBP-3 silencing inhibited the growth of HFF-1 cells. (A) qRT-PCR for measurement of IGFBP-3 expression. (B) The abundance of IGFBP-3 was examined by western blotting. (C) The viability of HFF-1 cells was detected by CCK8 assays. (D) Transwell assay for cell migration. Scale bar = 100 µm. The student’s t-test was used to analyze statistical significance. *p < 0.05 vs. si-NC group. NC: nitrocellulose; IGFBP-3: insulin-like growth factor binding protein-3.

3.6 miR-143-3p regulated testosterone-induced HFF-1 cell growth and AR expression via IGFBP-3

We wondered whether the regulation of miR-143-3p on testosterone-exposed HFF-1 cells was through IGFBP-3, given that IGFBP-3 is a target of miR-143-3p. To explore the relationship between miR-143-3p and IGFBP-3 in testosterone-induced HFF-1 cells, we introduced miR-143-3p mimics and the IGFBP-3 overexpression vector jointly. Additionally, miR-143-3p level exhibited an upward trend and IGFBP-3 level exhibited a downward trend in the miR-143-3p mimics group. Compared to the miR-143-3p mimics + oe-NC group, oe-IGFBP3 decreased miR-143-3p levels and increased IGFBP-3 levels (Fig. 6A). Additionally, miR-143-3p mimics reduced the protein abundances of IGFBP-3 and AR. However, oe-IGFBP3 elevated the protein levels of IGFBP-3 and AR compared to the miR-143-3p mimics + oe-NC group (Fig. 6B). Moreover, miR-143-3p mimics hindered HFF-1 cell proliferation. However, miR-143-3p mimics + oe-IGFBP3 resulted in stronger cell viability compared to the miR-143-3p mimics + oe-NC group (Fig. 6C). Similarly, the migration of HFF-1 cells was limited in the miR-143-3p mimics group. However, oe-IGFBP3 promoted HFF-1 cell migration compared to the miR-143-3p mimics + oe-NC group (Fig. 6D). Our observations suggested that miR-143-3p could inhibit IGFBP-3 to impede the proliferation, migration, and AR expression of testosterone-exposed HFF-1 cells.

miR-143-3p targeted IGFBP-3 to regulate testosterone-induced HFF-1 cell growth and AR expression. (A) qRT-PCR for measurement of miR-143-3p and IGFBP-3 expression. (B) Western blotting for detection of IGFBP-3 and AR. (C) HFF-1 cell viability was detected by CCK8 assays. (D) Transwell assay for cell migration. Scale bar = 100 µm. One-way ANOVA was used to analyze statistical significance. *p &lt; 0.05 vs. NC mimics group; &amp; p &lt; 0.05 vs. miR-143-3p mimics + oe-NC group. NC: nitrocellulose; AR: androgen receptor; IGFBP-3: insulin-like growth factor binding protein-3.

Fig. 6.miR-143-3p targeted IGFBP-3 to regulate testosterone-induced HFF-1 cell growth and AR expression. (A) qRT-PCR for measurement of miR-143-3p and IGFBP-3 expression. (B) Western blotting for detection of IGFBP-3 and AR. (C) HFF-1 cell viability was detected by CCK8 assays. (D) Transwell assay for cell migration. Scale bar = 100 µm. One-way ANOVA was used to analyze statistical significance. *p < 0.05 vs. NC mimics group; & p < 0.05 vs. miR-143-3p mimics + oe-NC group. NC: nitrocellulose; AR: androgen receptor; IGFBP-3: insulin-like growth factor binding protein-3.

4. Discussion

Hypospadias is a congenital malformation affecting the external male genitalia, which can lead to hypogonadism and increase the risk of cardiovascular disease in adulthood [38]. Given these phenomena, it is of great significance to explore the pathogenesis of hypospadias. Targeting proliferation, apoptosis, and the cell cycle of urethral plate fibroblasts may affect the progression of hypospadias [43]. Studies have shown that abnormal foreskin development affects the progression of hypospadias, and that HFF cells are critical for foreskin development [3]. Therefore, this study used HFF-1 cells in an attempt to investigate possible regulatory mechanisms. Our data showed that testosterone contributed to the proliferation and migration of HFF-1 cells and promoted AR expression, in part via miR-143-3p/IGFBP-3.

Testosterone, as an androgen, is essential to human health. The efficacy of testosterone replacement therapy for gonadal recovery and treating male disorders has already been proven [44, 45]. The reduction of testosterone levels often triggers hypogonadism and a physical decline in men, often manifested clinically as easy fatigue, loss of libido, erectile dysfunction, muscle and weight loss [46, 47, 48]. Notably, testosterone replacement therapy is considered the current standard practice for patients with gonadal dysfunction [49]. Preoperative androgen stimulation contributes to hypospadias repair [50, 51]. Abnormal androgen signaling is strongly associated with the development of hypospadias [52, 53], and testosterone has also been found to affect the outcome of hypospadias surgery [54]. From this, we hypothesized that testosterone might play a role in the growth of HFF-1 cells and, therefore, in the development of hypospadias. Our study findings showed that testosterone promoted the proliferation and migration of HFF-1 cells, and also promoted the accumulation of AR. Studies have shown that AR binds to testosterone, thereby regulating cell differentiation and proliferation to mediate prostate organogenesis and development [39]. AR has found to be closely associated with the development of hypospadias, and testosterone could increase AR expression in fibroblasts [40, 41]. These results suggested that testosterone could be participating in the pathogenesis of hypospadias by regulating HFF cell proliferation and migration, as well as AR signaling.

Recent reports indicate that miR-181a mediates H2O2-induced oxidative stress and HFF cell senescence [55]. Many reports have proven that miR-143-3p could be effective for different diseases [16]. miR-143-3p could regulate specific target genes in cancer, cardiovascular disease and other diseases, as well as affect the disease process. Previous studies have demonstrated that both testosterone and miR-143-3p can affect cell proliferation and differentiation, hinting at a possible regulatory relationship between them [56, 57]. Therefore, we investigated whether testosterone could regulate miR-143-3p. Our validation showed that testosterone could facilitate the migration and proliferation ability of HFF-1 cells, while overexpression of miR-143-3p could significantly restrain HFF-1 cell migration and proliferation. This information indicated that both testosterone and miR-143-3p could affect HFF-1 cell migration and proliferation. Testosterone has been shown to exert its effects by targeting miRNAs [58], leading us to hypothesize that testosterone and miR-143-3p might be connected. Further analysis revealed that testosterone downregulated the expression of miR-143-3p, which indicated that testosterone could negatively regulate miR-143-3p. It could be inferred that testosterone promoted the proliferation of HFF-1 cells by negatively regulating miR-143-3p, but specific regulatory mechanism involved remains unclear.

According to previous studies, testosterone has been shown to have a regulatory effect on the expression level of IGFBP-3 in humans [59], confirming that testosterone can regulate IGFBP-3. Our research has also supported this finding, as testosterone was found to positively regulate the expression of IGFBP-3. Furthermore, we observed that IGFBP-3 silencing reduced testosterone-induced proliferation and migration of HFF-1 cells, indicating that testosterone may increase the level of IGFBP-3 to promote the proliferation and migration of HFF-1 cells. It has been reported that IGFBP-3 can affect the progression of many cancers by inhibiting the binding of receptors and blocking their anti-apoptotic activity [60, 61, 62]. It has also been reported that IGFBP-3 inhibits angiogenesis and affects apoptosis [63, 64]. Accumulating reports indicate that IGFBP-3 acts as a target gene for some miRNAs [65]. For example, miR-449a plays a role in non-obstructive azoospermia [66]. Below physiological levels, corticosterone could target the miR-124-3p/HDAC5 axis to block testosterone synthesis [67]. These miRNAs are thought to target IGFBP-3, and their functions are closely related to testosterone levels, thus indicating the need for further research on IGFBP-3. Based on previous results, we considered whether IGFBP-3 is a target of miR-143-3p, thereby affecting testosterone-mediated regulation pathway. We found a miR-143-3p binding site on IGFBP-3 gene through bioinformatics prediction, thus providing an initial suggestion of a targeting relationship between the two factors. Subsequently, we verified that miR-143-3p directly targeted IGFBP-3 and regulated its expression by a dual-luciferase reporter assay. We found that miR-143-3p was negatively correlated with IGFBP-3, thus indicating that miR-143-3p could negatively regulate IGFBP-3. Based on these findings, we co-transfected miR-143-3p mimics and IGFBP-3 overexpression vector into testosterone-induced HFF-1 cells to further analyze that miR-143-3p was acting through IGFBP-3. We found that IGFBP-3 overexpression countered the inhibitory effect of miR-143-3p on HFF-1 cell proliferation and migration and AR expression. This result suggests that testosterone inhibits miR-143-3p to increase IGFBP-3, which ultimately promotes HFF-1 cell proliferation and migration and AR signaling.

Nevertheless, this study has some limitations that need to be taken into account. This study predominantly explored the effects of testosterone at the cellular level, and whether these findings can be validated in human and animal samples needs further study. Due to the limitation of funds and time, our mechanistic study did not include a blank group, that is, a group that was not treated with testosterone. Moreover, this study had limited exploration of phenotypes and mechanisms, such as the regulation of HFF-1 cell apoptosis, invasion, and cycle by testosterone; the relationship between AR signaling and HFF-1 cell growth; and the effect of miRNA on testosterone levels. Additionally, there is still insufficient conclusive evidence to establish a direct link between dysregulated HFF-1 cell growth and hypospadias. Further research is required to thoroughly investigate the intricate mechanisms and regulatory pathways of testosterone. Our future work aims at exploring this direction and achieving this objective.

5. Conclusions

This study was designed to examine the function of testosterone in the growth of HFF-1 cells and to confirm the underlying regulatory mechanisms involved. We propose that testosterone can regulate miR-143-3p to target IGFBP-3, thereby promoting the growth of HFF-1 cells and activating AR signaling. These findings could have significant implications for the treatment of male diseases such as hypospadias, possibly providing a novel idea for the therapeutic application of testosterone.

Availability of data and materials

The data used to support the findings of this study are available from the corresponding author upon request.

Author contributions

QLP, YWZ and WT—designed the study, performed the research, analysed data, and wrote the paper. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Acknowledgment

Not applicable.

Funding

This study was supported by Hunan Provincial Health Commission Scientific Research Project (20200748).

Conflict of interest

The authors declare no conflict of interest.

References

Ceccarelli PL, Lucaccioni L, Poluzzi F, Bianchini A, Biondini D, Iughetti L, et al. Hypospadias: clinical approach, surgical technique and long-term outcome. BMC Pediatrics. 2021; 21: 523.

[Google Scholar]

Gul M, Hildorf S, Silay MS. Sexual functions and fertility outcomes after hypospadias repair. International Journal of Impotence Research. 2021; 33: 149–163.

[Google Scholar]

Kaefer M, Rink R, Misseri R, Winchester P, Proctor C, Ben Maamar M, et al. Role of epigenetics in the etiology of hypospadias through penile foreskin DNA methylation alterations. Scientific Reports. 2023; 13: 555.

[Google Scholar]

Qin XY, Kojima Y, Mizuno K, Ueoka K, Muroya K, Miyado M, et al. Identification of novel low-dose bisphenol a targets in human foreskin fibroblast cells derived from hypospadias patients. PLOS ONE. 2012; 7: e36711.

[Google Scholar]

Wittert G, Grossmann M. Obesity, type 2 diabetes, and testosterone in ageing men. Reviews in Endocrine and Metabolic Disorders. 2022; 23: 1233–1242.

[Google Scholar]

Wang C, Swerdloff RS. Testosterone replacement therapy in hypogonadal men. Endocrinology and Metabolism Clinics of North America. 2022; 51: 77–98.

[Google Scholar]

Auerbach JM, Khera M. Testosterone replacement therapy and cardiovascular disease. International Journal of Impotence Research. 2022; 34: 685–690.

[Google Scholar]

Jin B, An H. Baicalin alleviates benign prostate hyperplasia through androgen-dependent apoptosis. Aging. 2020; 12: 2142–2155.

[Google Scholar]

Jang YJ, Jung HY, Myeong JY, Song KH, Kwon J, Kim D, et al. Effects of alginate oligosaccharide on testosterone-induced benign prostatic hyperplasia in orchiectomized rats. Nutrients. 2023; 15: 682.

[Google Scholar]

Godlewski KF, Mittal S, Hyacinthe N, Fischer K, Weaver J, Van Batavia J, et al. Does preoperative testosterone administration decrease complications in distal hypospadias repair with urethroplasty? The Journal of Urology. 2023. [Preprint].

[Google Scholar]

Stern JM, Chen J, Peters SB, Stahl PJ, El-Chaar M, Felsen D, et al. Testosterone treatment of human foreskin in a novel transplant model. Urology. 2004; 63: 999–1003.

[Google Scholar]

Hussen BM, Hidayat HJ, Salihi A, Sabir DK, Taheri M, Ghafouri-Fard S. MicroRNA: a signature for cancer progression. Biomedicine & Pharmacotherapy. 2021; 138: 111528.

[Google Scholar]

Michlewski G, Cáceres JF. Post-transcriptional control of miRNA biogenesis. RNA. 2019; 25: 1–16.

[Google Scholar]

Xu X, Guan R, Gong K, Xie H, Shi L. Circ_FURIN knockdown assuages testosterone-induced human ovarian granulosa-like tumor cell disorders by sponging miR-423-5p to reduce MTM1 expression in polycystic ovary syndrome. Reproductive Biology and Endocrinology. 2022; 20: 32.

[Google Scholar]

Kalinina T, Kononchuk V, Alekseenok E, Abdullin G, Sidorov S, Ovchinnikov V, et al. Associations between the levels of estradiol-, progesterone-, and testosterone-sensitive MiRNAs and main clinicopathologic features of breast cancer. Journal of Personalized Medicine. 2021; 12: 4.

[Google Scholar]

Wang Y, Li H, Shi Y, Wang S, Xu Y, Li H, et al. MiR-143-3p impacts on pulmonary inflammatory factors and cell apoptosis in mice with mycoplasmal pneumonia by regulating TLR4/MyD88/NF-κB pathway. Bioscience Reports. 2020; 40: BSR20193419.

[Google Scholar]

Jiang B, Yuan C, Han J, Shen M, Zhou X, Zhou L. MiR-143-3p inhibits the differentiation of osteoclast induced by synovial fibroblast and monocyte coculture in adjuvant-induced arthritic rats. BioMed Research International. 2021; 2021: 1–10.

[Google Scholar]

Tang J, Pan H, Wang W, Qi C, Gu C, Shang A, et al. MiR-495-3p and miR-143-3p co-target CDK1 to inhibit the development of cervical cancer. Clinical and Translational Oncology. 2021; 23: 2323–2334.

[Google Scholar]

Zhang G, Liu Z, Zhong J, Lin L. Circ‐ACAP2 facilitates the progression of colorectal cancer through mediating miR‐143‐3p/FZD4 axis. European Journal of Clinical Investigation. 2021; 51: e13607.

[Google Scholar]

Zhang L, Jiang H, Zhang Y, Wang C, Xia X, Sun Y. GR silencing impedes the progression of castration-resistant prostate cancer through the JAG1/NOTCH2 pathway via up-regulation of microRNA-143-3p. Cancer Biomarkers. 2020; 28: 483–497.

[Google Scholar]

Bonifacio LN, Jarstfer MB. MiRNA profile associated with replicative senescence, extended cell culture, and ectopic telomerase expression in human foreskin fibroblasts. PLOS ONE. 2010; 5: e12519.

[Google Scholar]

Song F, Zhou X, Hu Y, Li G, Wang Y. The roles of insulin-like growth factor binding protein family in development and diseases. Advances in Therapy. 2021; 38: 885–903.

[Google Scholar]

Song B, Xu J, Zhong P, Fang L. MiR-125a-5p silencing inhibits cerebral ischemia-induced injury through targeting IGFBP3. Folia Neuropathologica. 2021; 59: 121–130.

[Google Scholar]

Feng N, Wang Z, Wu Y, Zheng H, Jiang X, Wang Z, et al. ADAMTS9-as2 promotes angiogenesis of brain microvascular endothelial cells through regulating miR-185-5p/IGFBP-2 axis in ischemic stroke. Molecular Neurobiology. 2022; 59: 2593–2604.

[Google Scholar]

Kerr A, Baxter RC. Noncoding RNA actions through IGFs and IGF binding proteins in cancer. Oncogene. 2022; 41: 3385–3393.

[Google Scholar]

Jogie-Brahim S, Feldman D, Oh Y. Unraveling insulin-like growth factor binding protein-3 actions in human disease. Endocrine Reviews. 2009; 30: 417–437.

[Google Scholar]

Shih H, Chen C, Torng P. IGFBP3 inhibits angiogenesis through intracellular regulation of THBS1 expression. American Journal of Cancer Research. 2020; 10: 1728–1744.

[Google Scholar]

Hu D, Ge Y, Cui Y, Li K, Chen J, Zhang C, et al. Upregulated IGFBP3 with aging is involved in modulating apoptosis, oxidative stress, and fibrosis: a target of age-related erectile dysfunction. Oxidative Medicine and Cellular Longevity. 2022; 2022: 1–18.

[Google Scholar]

Chen X, Shao Y, Wei W, Shen H, Li Y, Chen Y, et al. Downregulation of LOX promotes castration-resistant prostate cancer progression via IGFBP3. Journal of Cancer. 2021; 12: 7349–7357.

[Google Scholar]

Yoshizawa A. Testosterone and insulin-like growth factor (IGF) I interact in controlling IGF-binding protein production in androgen-responsive foreskin fibroblasts. Journal of Clinical Endocrinology & Metabolism. 2000; 85: 1627–1633.

[Google Scholar]

Ouyang X, Feng L, Liu G, Yao L, Wang Z, Liu S, et al. Androgen receptor (AR) decreases HCC cells migration and invasion via miR-325/ACP5 signaling. Journal of Cancer. 2021; 12: 1915–1925.

[Google Scholar]

Chen Q, Zhang H, Yang Y, Zhang S, Wang J, Zhang D, et al. Metformin attenuates UVA-induced skin photoaging by suppressing mitophagy and the PI3K/AKT/mTOR pathway. International Journal of Molecular Sciences. 2022; 23: 6960.

[Google Scholar]

Liu X, Song YJ, Chen X, Huang MY, Zhao CX, Zhou X, et al. Asiaticoside combined with carbon ion implantation to improve the biocompatibility of silicone rubber and to reduce the risk of capsule contracture. Frontiers in Bioengineering and Biotechnology. 2022; 10: 810244.

[Google Scholar]

Wang BJ, Huang SH, Kao CL, Muller CJF, Wang YP, Chang KH, et al. Aspalathus linearis suppresses cell survival and proliferation of enzalutamide-resistant prostate cancer cells via inhibition of c-Myc and stability of androgen receptor. PLOS ONE. 2022; 17: e0270803.

[Google Scholar]

Ding M, Jiang C, Zhang Y, Zhao J, Han B, Xia S. SIRT7 depletion inhibits cell proliferation and androgen-induced autophagy by suppressing the AR signaling in prostate cancer. Journal of Experimental & Clinical Cancer Research. 2020; 39: 28.

[Google Scholar]

Ma L, Dong L, Zhu J, Yu J, Deng Q. Exploration of potential therapeutic targets for stroke based on the GEO database. Annals of Translational Medicine. 2021; 9: 1759–1759.

[Google Scholar]

Liang D, Tian C, Zhang X. lncRNA MNX1‑AS1 promotes prostate cancer progression through regulating miR-2113/MDM2 axis. Molecular Medicine Reports. 2022; 26: 231.

[Google Scholar]

Lucas-Herald AK, Montezano AC, Alves-Lopes R, Haddow L, Alimussina M, O’Toole S, et al. Vascular dysfunction and increased cardiovascular risk in hypospadias. European Heart Journal. 2022; 43: 1832–1845.

[Google Scholar]

Jamroze A, Chatta G, Tang DG. Androgen receptor (AR) heterogeneity in prostate cancer and therapy resistance. Cancer Letters. 2021; 518: 1–9.

[Google Scholar]

Chao chen, Jian Y, Zhao X, Liu Y, Xie Q. The involvement of hsa_circ_0000417 in the development of hypospadias by regulating AR. Differentiation. 2020; 116: 9–15.

[Google Scholar]

Vottero A, Minari R, Viani I, Tassi F, Bonatti F, Neri TM, et al. Evidence for epigenetic abnormalities of the androgen receptor gene in foreskin from children with hypospadias. The Journal of Clinical Endocrinology & Metabolism. 2011; 96: E1953–E1962.

[Google Scholar]

Yang C, Xu X, Lin P, Luo B, Luo S, Huang H, et al. Overexpression of long noncoding RNA MCM3AP-as1 promotes osteogenic differentiation of dental pulp stem cells via miR-143-3p/IGFBP5 axis. Human Cell. 2022; 35: 150–162.

[Google Scholar]

An N, Peng J, He G, Fan X, Li F, Chen H. Involvement of activation of mitogen-activated protein kinase (MAPK)/Extracellular signal-regulated kinase (ERK) signaling pathway in proliferation of urethral plate fibroblasts in finasteride-induced rat hypospadias. Medical Science Monitor. 2018; 24: 8984–8992.

[Google Scholar]

Di Lodovico E, Facondo P, Delbarba A, Pezzaioli LC, Maffezzoni F, Cappelli C, et al. Testosterone, hypogonadism, and heart failure. Circulation: Heart Failure. 2022; 15: e008755.

[Google Scholar]

Jayasena CN, Anderson RA, Llahana S, Barth JH, MacKenzie F, Wilkes S, et al. Society for endocrinology guidelines for testosterone replacement therapy in male hypogonadism. Clinical Endocrinology. 2022; 96: 200–219.

[Google Scholar]

Garibotto G, Esposito P, Picciotto D, Verzola D. Testosterone disorders and male hypogonadism in kidney disease. Seminars in Nephrology. 2021; 41: 114–125.

[Google Scholar]

Corona G, Maggi M. The role of testosterone in male sexual function. Reviews in Endocrine and Metabolic Disorders. 2022; 23: 1159–1172.

[Google Scholar]

Anawalt BD, Matsumoto AM. Aging and androgens: physiology and clinical implications. Reviews in Endocrine and Metabolic Disorders. 2022; 23: 1123–1137.

[Google Scholar]

Barbonetti A, D’Andrea S, Francavilla S. Testosterone replacement therapy. Andrology. 2020; 8: 1551–1566.

[Google Scholar]

Wong NC, Braga LH. The influence of pre-operative hormonal stimulation on hypospadias repair. Frontiers in Pediatrics. 2015; 3: 31.

[Google Scholar]

Mittal S, Eftekharzadeh S, Christianson SS, Hyacinthe N, Tan C, Weiss DA, et al. Quantifying glans width changes in response to preoperative androgen stimulation in patients undergoing hypospadias repair. The Journal of Urology. 2022; 207: 1314–1321.

[Google Scholar]

Chen Z, Lin X, Wang Y, Xie H, Chen F. Dysregulated expression of androgen metabolism genes and genetic analysis in hypospadias. Molecular Genetics & Genomic Medicine. 2020; 8: e1346.

[Google Scholar]

Richard MA, Sok P, Canon S, Nembhard WN, Brown AL, Peckham-Gregory EC, et al. Altered mechanisms of genital development identified through integration of DNA methylation and genomic measures in hypospadias. Scientific Reports. 2020; 10: 12715.

[Google Scholar]

Taghavi K, O’Hagan LA, Hewitt JK, Mouriquand PD. Defining the role of pre-operative hormonal therapy in hypospadias. Journal of Paediatrics and Child Health. 2022; 58: 1508–1519.

[Google Scholar]

Huang Y, Yan H, Yang Y, Zhou J, Xu Q, Meng H. Downregulated miR-181a alleviates H2O2-induced oxidative stress and cellular senescence by targeting PDIA6 in human foreskin fibroblasts. Anais Brasileiros de Dermatologia. 2023; 98: 17–25.

[Google Scholar]

Mudali S. Effects of testosterone on body composition of the aging male. Mechanisms of Ageing and Development. 2004; 125: 297–304.

[Google Scholar]

Wang R, Zhang H, Ding W, Fan Z, Ji B, Ding C, et al. miR-143 promotes angiogenesis and osteoblast differentiation by targeting HDAC7. Cell Death & Disease. 2020; 11: 179.

[Google Scholar]

Chodari L. The effect of testosterone and voluntary exercise, alone or together, on miRNA-126 expression changes in heart of diabetic rats. Acta Endocrinologica. 2017; 13: 266–271.

[Google Scholar]

Rooman RPA, De Beeck LO, Martin M, van Doorn J, Mohan S, Du Caju MVL. Ethinylestradiol and testosterone have divergent effects on circulating IGF system components in adolescents with constitutional tall stature. European Journal of Endocrinology. 2005; 152: 597–604.

[Google Scholar]

Long Z, Gong F, Li Y, Fan Z, Li J. Circ_0000285 regulates proliferation, migration, invasion and apoptosis of osteosarcoma by miR-409-3p/IGFBP3 axis. Cancer Cell International. 2020; 20: 481.

[Google Scholar]

Zielinska HA, Daly CS, Alghamdi A, Bahl A, Sohail M, White P, et al. Interaction between GRP78 and IGFBP-3 affects tumourigenesis and prognosis in breast cancer patients. Cancers. 2020; 12: 3821.

[Google Scholar]

Cai Q, Dozmorov M, Oh Y. IGFBP-3/IGFBP-3 receptor system as an anti-tumor and anti-metastatic signaling in cancer. Cells. 2020; 9: 1261.

[Google Scholar]

Li C, Liu B, Wang Z, Xie F, Qiao W, Cheng J, et al. Salvianolic acid B improves myocardial function in diabetic cardiomyopathy by suppressing IGFBP3. Journal of Molecular and Cellular Cardiology. 2020; 139: 98–112.

[Google Scholar]

Tao A, Wang X, Li C. Effect of lycopene on oral squamous cell carcinoma cell growth by inhibiting IGF1 pathway. Cancer Management and Research. 2021; 13: 723–732.

[Google Scholar]

Chen S, Tang Y, Liu Y, Zhang P, Lv L, Zhang X, et al. Exosomes derived from miR-375-overexpressing human adipose mesenchymal stem cells promote bone regeneration. Cell Proliferation. 2019; 52: e12669.

[Google Scholar]

Lv M, Zhou L, Ge P, Li Y, Zhang J, Zhou D. Over‐expression of hsa_circ_0000116 in patients with non‐obstructive azoospermia and its predictive value in testicular sperm retrieval. Andrology. 2020; 8: 1834–1843.

[Google Scholar]

Liu M, Liu Y, Pei L, Zhang Q, Xiao H, Chen Y, et al. Prenatal dexamethasone exposure programs the decreased testosterone synthesis in offspring rats by low level of endogenous glucocorticoids. Acta Pharmacologica Sinica. 2022; 43: 1461–1472.

[Google Scholar]