Assessment of male football players’ physical fitness levels based on certain gene (AGT rs699 & IL-6 rs1800795) polymorphisms

1. Introduction

Research has shown that genetic variation is significantly associated with athletic performance, with peak performance often dependent on specific base pair configurations [1, 2, 3]. However, it is important to emphasize that genetics is not the only determinant of athletic performance. Factors such as environmental conditions, epigenetic interactions, lifestyle choices, dietary habits, and changes in motivational dynamics play a crucial role in shaping athletic outcomes and exert a significant influence on an athlete’s performance in their respective discipline [4, 5, 6, 7, 8]. In addition, complex traits that constitute an essential aspect of physical performance, such as endurance, muscular strength, power, speed, and agility, have been reported to require a very specific genetic combination [5, 9, 10]. The corresponding matches in DNA sequences have a positive effect on adaptation to physiological changes in metabolism caused by athletic stress and the development of peak performance [11, 12].

A previous investigation identified over 250 genetic variations connected to athletic prowess. Of these, 128 variants have shown a positive correlation in several studies; in particular, 41 are associated with endurance, 45 with power, and 42 with strength [1]. The angiotensin (AGT) gene and its polymorphisms, including rs699, which is associated with power sports performance, and the interleukin 6 (IL-6) gene and its variants, such as rs1800795, which affects general physical fitness, are of particular importance in the development of athletic performance [1, 13, 14]. The AGT gene, which plays a role in the maintenance of physical performance, consists of a 1455-nucleotide sequence translated into 485 amino acids and is located on chromosome 1 at locus 1q42.2. The AGT Met235Thr (T > C) variation has been associated with increased speed, power, and strength in elite athletes [10]. Furthermore, AGT is recognized as a genetic factor that is advantageous for exercise or physical activities, particularly regarding skeletal muscles, peripheral blood flow, and blood pressure regulation [15, 16].

The role of the renin-angiotensin system (RAS) is crucial when considering AGT in the context of hypertension and cardiovascular, renal, and salt-sensitive diseases. AGT, a protein synthesized in the liver, is a key element of the RAS. Renin converts AGT into angiotensin I, which is a precursor of angiotensin II. Angiotensin II is instrumental in controlling vascular resistance and maintaining sodium balance, primarily through vasoconstriction [17]. Elevated AGT levels lead to increased production of angiotensin II, which in turn can cause an increase in blood pressure. The Met235Thr (T > C) variant in the AGT gene, in which methionine is replaced by threonine at the 235th position of the protein, has been associated with notable changes in blood pressure control, increased risk of hypertension, and elevated plasma AGT levels [18, 19, 20].

The IL-6 rs1800795 gene polymorphism is another genetic variant that plays a significant role in the development of physical performance levels, including conditioning, muscle repair, and hypertrophy. IL-6 functions as both a cytokine and a myokine and is located at position 7p15.3 [21]. Its primary biological effects, such as cell survival, proliferation, differentiation, immune response, and apoptosis, are mediated by its interaction with the interleukin-6 receptor alpha, which is predominantly found in inflamed tissue. IL-6 is not only crucial for immune functions but also influences various aspects of athletic performance [22, 23, 24].

The production of IL-6 is influenced by a specific genetic variation, where a guanine base at position 174 is replaced by cytosine. This C/G polymorphism (rs1800795), located in the 5′flanking region of the gene, has functional implications. Studies have shown that the C allele is linked to lower plasma levels of IL-6, whereas the G allele is associated with enhanced power-based physical attributes like strength and speed. In addition, the C allele is frequently found in individuals with a predisposition to endurance, which is attributed to its role in reducing endogenous glucose synthesis and increasing lipid oxidation [25, 26]. Research in the field of athletic performance is increasingly focusing on the exploration of genetic variations and their significant effects on individual performance capabilities [8, 24].

Genetic markers, including AGT and IL-6, have been identified as influential in athletic performance in different ethnic groups [15, 18, 19, 26]. Nevertheless, there is a paucity of literature on the pre- and post-test results of various athletic performance measures in male football players. The main aim of this study is to investigate the associations between the AGT and IL-6 gene polymorphisms and the improvement of athletic performance in elite male football players after a six-week training intervention. To achieve this goal, a series of tests focusing on athletic ability were conducted.

2. Materials and methods

2.2 Procedure

During the six-week pre-season preparation period, all participants adhered to an intensive training schedule that spanned six days per week. Training sessions varied in length, lasting anywhere from 35 to 150 minutes each. The training was carefully organized into two microcycles per week, with each microcycle comprising three unique training sessions. Notably, these training sessions were held twice daily, once in the morning and once in the evening, leading to a total weekly training time of around 900 minutes. The program was thoughtfully designed to include a variety of exercises aimed at improving both anaerobic and aerobic fitness, enhancing both intermuscular and intramuscular coordination, and increasing speed and plyometric training intensity. Further specifics of this program can be found in Table 1.

Table 1.The training program for 1 microcycle in the pre-season.

Week 1	Monday	Tuesday	Wednesday	Thursday	Friday	Saturday	Sunday
Morning	Strength training session	Coordination and basic plyometrics	Strength training session	Regeneration	Strength training session	Coordination and basic plyometrics	Strength training session
Evening	Football training and aerobic endurance training	Football training and aerobic endurance training	Preparation of match/compensation training for nonstarters and less-minuted players	Free	Football training and aerobic endurance training	Football training and aerobic endurance training	Preparation of match/compensation training for nonstarters and less-minuted players
Volume	65 + 85 min	75 + 70 min	40 + 90 min	35–40 min	65 + 85 min	75 + 70 min	40 + 90 min
Intensity	Moderate-high	High	Moderate-high	Low	Moderate-high	High	Moderate-High
Metabolic load	75–90% MHR	95% MHR	75–90% MHR	50–60% MHR	75–90% MHR	90% MHR	75–90% MHR
Mechanical load	<5000–6000 m	6000–7000 m	9000–13000 m	1000–2000 m	<5000–6000 m	6000–7000 m	9000–13000 m
MHR: Maximum Heart Rate.

2.2.1 Sample collection

Before and after the six-week training program, the male football players were subjected to physical evaluations. The same testing protocols were applied for both initial and final assessments. Given their experience in training and testing, the athletes were familiar with the procedures. A general warm-up phase, including light jogging and stretching exercises for both upper and lower limbs, preceded the actual tests. This was followed by submaximal efforts to prepare the athletes for the upcoming tests. Physical jump tests were conducted using the Optojump system (Optojump; version, 1.14.0, Microgate, Italy), with each jump test performed five times. The best performance out of these was recorded for later analysis, adhering to standard evaluation practices. Body fat percentage was measured using the Jackson Pollock method, which involves taking skinfold readings from seven different body areas using the Harpenden Caliper to calculate fat percentages.

The athletes underwent a comprehensive set of performance tests designed to measure various aspects of physical fitness. These included the Squat Jump (SJ) and Counter Movement Jump Test (CMJ) for assessing leg strength and vertical jump ability, and the Drop Jump Test (DJ) for evaluating reactive and explosive strength, using the Optojump device. The testing also included the Yo-Yo Intermittent Recovery Test Level 2 (Yo-Yo IRT 2) for recovery assessment and a One Repetition Maximum (1RM) test for maximal muscle strength in bench pressing. Sprinting skills over 5 m, 10 m and 30 m were measured using the Witty photosensor system. The entire testing process spanned two days, with a day’s break in between. The first day involved the Body Fat Percentage, CMJ, DJ, and Yo-Yo IRT 2 tests, while after a two-day rest, the second phase included the 1RM test and the 5 m, 10 m and 30 m sprints. The sprint tests were conducted on a football field, while the other assessments took place in a gym setting.

2.2.2 Vertical jump testing

In the SJ test, participants placed their hands on their hips, bent their knees to 90°, and performed five jumps with 15-second breaks. The best jump was recorded. For the CMJ, participants were instructed to fully extend their legs after a downward movement, with the extent of the countermovement left to their choice. They kept their hands on their hips throughout. Both SJ and CMJ involved five jumps with 15-second intervals. An Infrared Contact Platform (Optojump) measured the flight time of each jump, allowing the calculation of jump height using the formula h = gt²/8 (g = 9.81 m/s²). Consistency in take-off and landing was required for a jump to be valid. The highest jump from each test was used for data analysis [27].

2.2.3 Yo-Yo IRT 2 test

The Yo-Yo IR 2 test is a key tool in sports science for assessing an athlete’s fitness, particularly in team sports. It measures the ability to perform repeated high-intensity exercises, tapping into both aerobic and anaerobic energy systems. The test involves shuttle runs of 40 meters (two 20-meter segments) with increasing speed, interspersed with 10-second active recovery periods, guided by audio cues. Athletes continue until they cannot keep up with the increasing pace, with the test ending if they fail to reach the marker twice in a row. Typically lasting 5 to 15 minutes, it evaluates an individual’s capacity for high-intensity exercise with significant anaerobic energy use [28].

2.2.4 1RM of bench press

The One Repetition Maximum (1RM) test is a method used to assess the maximum weight an individual can lift in a single repetition of an exercise. The test begins with a warm-up phase where participants engage in submaximal repetitions to prepare their muscles for the exertion. This is followed by the testing phase, which starts at 50–70% of the participant’s estimated capacity. The weight is gradually increased in increments of 2.5 kg, up to 20 kg, until the participant is unable to complete a repetition. A specific example of the 1RM test is the bench press technique. This involves the participant lying down on the bench with their feet flat on the ground and maintaining contact at five points: the feet, calves, upper, back, and head. The participant grips the barbell at shoulder width and lifts it in a controlled manner. The determination of the 1RM is a critical part of the test. After completing the warm-up sets, the participant attempts the maximal lift. The weight is increased in subsequent attempts, with three-minute rest intervals between each attempt. This process continues until the participant is unable to complete a repetition. The weight lifted in the last successful attempt is recorded as 1RM. This value is significant as it represents the maximum strength capacity of the individual for that particular exercise [29, 30].

2.2.5 Sprint tests

Before starting the speed tests, six pairs of Witty Speed photocells from Microgate Equipment were set up at 0, 5, 10, 20 and 30 meters along a track. Male football players then performed two sprints each, starting 0.5 meters behind the line, in an indoor facility to avoid weather effects. Times for each distance were recorded to calculate sprint velocity and assess acceleration at different intervals (0–5 m, 5–10 m, 10–20 m and 20–30 m). A 5-minute rest between sprints ensured recovery and consistent performance. The fastest time from the two sprints was used for analysis.

2.2.6 Body fat (%)

The measurements were meticulously conducted, employing a Harpenden Skinfold Caliper, manufactured by Habdirect UK, at seven body sites, and body density and body fat percentage were calculated using the equations of Jackson and Pollock [31].

2.2.7 Genotyping

The epithelial cell samples were collected after obtaining signed consent forms from all participants. The working procedures were conducted following the principles of the Helsinki Declaration. DNA isolation was performed using the commercially available Canvax DNA Isolation Kit (Canvax Reagents S.L., AN0036, C. Luis de Mercado, Boecillo, Valladolid, Spain), following the manufacturer’s instructions. All genotyping procedures were conducted using Real-Time PCR (StepOne Plus, USA). For the genotyping process, AGT rs699 and IL-6 rs1800795 TaqMan Single Nucleotide Polymorphism (SNP) Genotyping Assays (Thermo Fisher, USA) were utilized as per the manufacturer’s guidelines. Genotyping was completed using 5 μL of master mix, 3.75 μL of H₂O, 0.25 μL of the assay, and 1 μL (10 ng) of DNA, totaling 10 μL. The TaqMan Probe sequences used for genotyping are presented in Table 2. The C allele for the 5-Carboxyfluorescein (5-FAM) primer and the T allele for the 2′-chloro-7′-phenyl-1,4. dichloro-6-carboxyfluorescein (VIC) primer, used in the AGT TaqMan SNP Genotyping Assay, were identified (Fig. 1). Similarly, the G allele for the FAM primer and the C allele for the VIC primer, used in the IL-6 TaqMan SNP Genotyping Assay, were identified (Fig. 2).

Table 2.Sequences of the TaqMan probe used for genotyping AGT rs699 and IL-6 rs1800795 polymorphisms.

qPCR	Genes	Sequence, 5′-3′
	AGT	CAGGGTGCTGTCCACACTGGCTCCC[A/G] TCAGGGAG CAGCCAGTCTTCCATCC
	IL-6	ACTTTTCCCCCTAGTTGTGTCTTGC[C/G] ATGCTAAAG GACGTCACATTGCACA
qPCR: Quantitative Polymerase Chain Reaction; AGT: Angiotensinogen; IL-6: Interleukin 6.

Fig. 1.The relationship between (A) Yo-Yo IRT-2, (B) 10 m sprint, 1RM (C) and AGT (rs699) gene polymorphism (CC, CT, and TT). *: p < 0.05. IRT: Intermittent Recovery Test; 1RM: One Repetition Maximum.

Fig. 2.The relationship between (A) Yo-Yo IRT-2, (B) 10 m sprint, 1RM (C) and IL-6 (rs1800795) gene polymorphism (CC, CG, and GG). *p < 0.005; <0.001. IRT: Intermittent Recovery Test; 1RM: One Repetition Maximum.

3. Results

The present study investigated the possible association between certain aspects of athletic performance and AGT and IL-6 gene polymorphisms. A cohort of twenty-two football players was selected for this study.

The training program for a single microcycle during the pre-season preparation phase is outlined in Table 1. The results shown in Table 3 come from using the paired-sample t-test on the group of football players, depending on how their AGT genotype variable was categorized. The comprehensive analysis elucidated a lack of statistically significant differences across various variables, including SJ, 5 m, 30 m, CMJ, DJ evaluations, and body fat percentage (p > 0.005). Nevertheless, the present study unveiled that the outcomes from the Yo-Yo IRT 2, 10 m, and 1RM tests exhibited statistically significant differences (Yo-Yo IRT 2: CC and CT p = 0.005, <0.001; 10 m: CT p = 0.024; 1RM: CC, CT and TT p ≤ 0.001, <0.001 and 0.045, respectively) (Fig. 1).

Based on the IL-6 genotype variable, Table 4 shows that there were no statistically significant differences (p > 0.05) between the variables that were looked at in this study for SJ, 5 m, 30 m, CMJ, DJ tests, and body fat percentage. Still, there was a statistically significant difference between the results of the Yo-Yo IRT 2, 10 m and 1RM tests (Fig. 2). More specifically, there was a significant difference in the Yo-Yo IRT 2 performance depending on the allelic permutations of CC, CG and GG, with p-values of 0.002, 0.021 and <0.001, respectively. In a similar vein, during the 10 m sprint test, the CC and GG genotypes displayed a lack of significant difference, registering a p-value of 0.020 and 0.028, respectively. The results of the 1RM test revealed significant differences linked to the CC and GG genotypes, yielding corresponding p-values of < 0.001 and <0.001, respectively. The effect sizes (Cohen’s d) corresponding to the statistically significant outcomes are reported in Tables 3 and 4.

4. Discussion

The emergence of sports genomics in scholarly research gained momentum following the groundbreaking discovery of the human DNA structure and the identification of initial DNA polymorphisms Angiotensin-Converting Enzyme (ACE) & Alpha-Actinin-3 (ACTN3) linked to athletic prowess [13, 35, 36]. Factors such as speed, strength, endurance, agility, recuperation speed, susceptibility to injuries, and the propensity for using performance-enhancing substances in elite athletes are shaped by the precise arrangement of nucleotides in the billions of base pairs in human DNA [37, 38]. Current research is increasingly concentrating on examining either individual or combined gene effects to understand how genetic variations influence various athletic attributes like speed, strength, endurance, and recovery in both professional and non-professional athletes [1, 39, 40, 41].

The present study reveals that there were no statistically significant differences in variables such as SJ, 5 m, 30 m, CMJ, DJ, and body fat percentage values based on both AGT and IL-6 genotypes. However, it was observed that for both gene polymorphisms, the results obtained from the Yo-Yo IRT 2, 10 m, and 1RM tests for specific genotype groups demonstrated significant and noteworthy variations. This study underscores the impact of genotype categorization on performance, particularly emphasizing the pivotal role played by the Yo-Yo IRT 2, 10 m, and 1RM tests, where statistically significant disparities were evident.

Prior studies have identified genes like AGT and IL-6 as potential influencers of individual athletic performance, particularly in competitive team sports such as football, basketball, and rugby, focusing on the development of physical abilities [13, 19, 42, 43, 44, 45]. Research in this area has shown that different genetic variants, including the AGT gene, can distinguish short-distance runners from endurance athletes and the general population [46]. In a remarkable study, it was found that people with the Met235Thr C allele of the AGT gene had significantly increased AGT levels in their blood. This allele is associated with higher levels of angiotensin II, which promotes skeletal muscle growth, which can be beneficial for sports that require power and strength. This can be seen in strength athletes such as throwers, sprinters, and jumpers who show the benefits of this genetic trait [14].

In a study by Aleksandra et al. [15], the impact of the AGT M235T genotype on the response to a 12-week aerobic dance training program was examined, with a focus on strength-related variables like SJ and CMJ. The study found that the C allele led to greater improvements in these variables compared to TT homozygotes, suggesting that the AGT M235T polymorphism could be a significant genetic marker for predicting training response and for traits related to power and strength. However, a study by Bulgay et al. [47], which examined the AGT rs699 gene polymorphism in professional male football players and sedentary individuals, found no significant differences in AGT polymorphisms and alleles between the two groups, although a higher proportion of CT genotypes and C allele carriers was observed in both groups.

In the current study, no significant differences were found in SJ, 5 m, 30 m, CMJ, DJ, or body fat percentage in male football players based on the AGT gene variations (p > 0.05). However, significant differences were observed in the 10 m sprint tests in favor of the CT genotype and the Yo-Yo IRT 2 and 1RM tests in favor of both CC and CT genotypes (p < 0.05) (Table 3; Fig. 1). These findings suggest that while AGT gene polymorphism may not influence all aspects of athletic performance, it could have a notable impact on specific performance traits such as sprinting ability and response to certain types of training.

The IL-6 rs1800795 polymorphism, identified as another key genetic marker, is believed to influence the development of power-based physical performance, particularly in individuals with the G allele [25]. Research by Eynon et al. [48] showed a higher frequency of the GG genotype and G allele in national/international-level athletes engaged in strength and endurance sports. In another study with strength athletes (n = 158) and non-athletic volunteers (n = 254), a higher incidence of the GG genotype and the G allele was also found in the group of athletes [21]. Studies focusing on the status of athletes have shown that the polymorphism of the IL-6 gene GG is a common variant in athletes who specialize in strength and performance [26]. Tuna et al. [49] observed that professional swimmers (n = 45) had higher rates of the GG genotype and G allele compared to a control group (n = 30), but no significant difference was found in the IL-6 rs1800795 polymorphism between swimmers and the control group, nor was there a correlation between swimming styles/distances and genotypes. Ruiz et al. [46] found that endurance and power athletes had significantly higher frequencies of the GG genotype and G allele compared to other groups. Ulucan et al. [50] investigated the IL-6 rs1800795 polymorphism in ski athletes and found an equal distribution of GG and GC genotypes, with the CC genotype absent (75% G allele, 25% C allele). Cenikli et al. [51] reported no significant difference in the IL-6 G174C variant frequencies between elite athletes and control groups.

In this study, the IL-6 polymorphism in male football players was more commonly found in the GG variants compared to CG and CC (Table 3). No significant differences were observed in physical fitness tests (SJ, 5 m, 30 m, CMJ, DJ) and body fat percentage based on IL-6 genotype in these players (p > 0.005). However, the Yo-Yo IRT 2, 10 m, and 1RM test results showed significant differences favoring the CC, CG, and GG genotypes (p < 0.005; Table 3). This contrasts with Huuskonen et al. [52], who found the greatest improvement in VO₂ max performance in participants with the CG genotype after an eight-week training program. It can be said that while the IL-6 rs1800795 polymorphism appears to be a prevalent genetic variant among athletes, particularly those in power and endurance sports, its impact on specific physical performance measures can vary. This study’s findings suggest that while certain IL-6 genotypes (CC, CG, GG) may confer advantages in specific fitness tests, they do not uniformly affect all aspects of physical performance in male football players. Additionally, the role of IL-6 in immune system regulation and its potential link to pro-inflammatory responses highlights the complexity of its influence on athletic performance.

The insights gained from studying the AGT and IL-6 gene polymorphisms, particularly their impact on training adaptations among male football players, hold considerable practical value. Understanding the link between these genetic variations and the body’s response to training can be highly beneficial for coaches and sports professionals. This knowledge paves the way for creating customized training plans that consider the unique genetic makeup of each athlete. Coaches, by recognizing players with these specific gene polymorphisms, can tailor training methods to maximize their potential for improved adaptability and performance. Furthermore, the categorization of genotypes can play a crucial role in assessing physical fitness. Tests like the Yo-Yo IRT 2, 10 m, and 1RM, which are indicative of muscle power and inflammation responses, can be more effectively utilized to monitor an athlete’s development, factoring in their genetic predispositions. This genetic information is also invaluable for sports medicine experts and coaches in devising strategies for injury prevention. Athletes with certain genotypes, for instance, might be more susceptible to inflammation-related issues, necessitating adjusted recovery plans or workload management to reduce injury risks and enhance preventive measures. Moreover, tailoring training programs to align with the genetic profiles of professional athletes and adjusting training loads on an individual basis could lead to improvements in both individual and team performances. A key consideration is the extent to which these candidate genes can predict specific abilities or performance outcomes in sports. This approach represents a significant shift towards more personalized and effective training methodologies in sports, particularly in football.

5. Conclusions

In conclusion, the study suggests that AGT and IL-6 genetic variations may influence training adaptations in male football players, with notable performance differences observed in Yo-Yo IRT 2, 10 m and 1RM tests based on genotypes. This insight could be pivotal in shaping training programs that are more aligned with athletes’ genetic predispositions, potentially aiding coaches in steering athletes towards sports disciplines where they are most likely to excel.

6. Limitations and future research

The study’s limitations include limited sample sizes, the impact of football players’ intense training schedules, the need for long-term research to understand the relationship between genetics and training adaptation, the importance of examining a broader range of genetic variations, and the necessity of conducting research across various sports disciplines. Additionally, the ethical issues associated with genetic testing should also be considered.

Further research is needed to address limitations and fully explore the link between AGT and IL-6 polymorphisms in male football players. Future studies should use multigenetic analysis in larger, diverse groups (including female/male athletes of different age groups and sports disciplines) and consider epigenetic factors. Additionally, considering the physical and physiological differences among football players based on their positions could be a further research question, as it would be beneficial to assess genetic polymorphisms in a broad sample group, categorized by playing positions.

Availability of data and materials

Data are available for research purposes upon reasonable request to the corresponding authors.

Author contributions

CB, MD, and MC—designed the research study. CB, MC, HİC and MD—wrote the manuscript. OG, NLB, SYT and TP—performed the research. VOÇ, MSK and KU—analyzed the data. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Before the study commenced, the athletes signed consent forms containing all information such as the study protocol and use of the data. Tetowa University Ethics Committee approved the study protocol (2022/02-1474/1), and the study procedure was conducted following the principles of the Helsinki Declaration.

Acknowledgment

The authors are grateful to all participants who kindly provided their samples for DNA analysis and athletic performance.

Funding

This research received no external funding.

Conflict of interest

The authors declare no conflict of interest.